Friends of Wachusett Mountain is a non-profit group dedicated to conservation,
environmental education and land stewardship at Wachusett Mountain.
Ecological Genetics of Local Adaptation in Spotted Salamanders (Ambysoma maculatum)
Veronica J. Conant and Brian R. Bettencourt, University of Massachusetts Lowell
Abstract:
The goal of our research was to use genetic analysis to determine whether the unique environment of Wachusett Mountain may be driving a population of spotted salamanders toward local adaptation. In order to measure genetic variability within and between these populations, we developed an assay to examine restriction fragment length polymorphisms in the mitochondrial ND4 gene in individual salamanders from pools in Wachusett Mountain State Reservation and other ponds in central and eastern Massachusetts. Our results indicate that there is a high degree of endemism within local populations. For example, an allele present in an average of 12.24% of Wachusett salamanders is present in 83.33% of Westford salamanders. Preliminary analysis indicates that ND4 allele frequency is significantly associated with both environmental and biological features (elevation and body mass, respectively) and we are currently extending this study to additional populations and to nuclear genetic markers.
Introduction:
Spotted salamanders (Ambystoma maculatum) are a common species in Massachusetts that spend most of their lives living cryptically, just below the surface within upland forests. As temperatures warm in the spring and rains come, salamanders migrate to vernal pools to breed. Previous field studies indicate that spotted salamanders show significant fidelity to breeding habitats consisting of clustered groups of breeding sites (Petranka 2004). This characteristic makes the species a good candidate for population genetics studies, particularly with regard to selective pressures introduced by the environment. The summit of Wachusett Mountain provides a particularly unique environment for its population of spotted salamanders. Scott Smyers and colleagues (Oxbow Associates, Inc.) have been collecting physiological and environmental data on populations of spotted salamanders throughout Massachusetts since 2001. He has found that spotted salamanders on Wachusett Mountain are significantly larger and attain reproductive maturity later than salamanders from other surrounding populations. Candidate environmental factors driving local adaptation involve (1) the topsoil of the summit which is thicker and holds more moisture than soils at surrounding sites; (2) elevational variables (climate differences); and (3) hydroperiod of the aquatic habitat. Local adaptation driven by selective pressures requires genetic differentiation among populations. We performed a preliminary genetic analysis of Wachusett and other Massachusetts salamanders to determine whether the phenotypically distinct population on Wachusett Mountain is genetically distinct from lowland populations.
H0: For any two populations under consideration, the allele frequencies will not differ from one another.
Ha: There are significant differences in allele frequencies between populations.
Materials and Methods:
Whole larvae and toes from adult salamanders were collected in 2004 by Scott Smyers and colleagues (Oxbow Associates, Inc.) and preserved in ethanol.
DNA from toes was extracted using a modified snake skin protocol (Fetzner 1999).
Livers were dissected from the larvae, and DNA was extracted by digestion in lysis buffer (Tris-Cl, EDTA, NaCl, SDS) with fresh Proteinase K added, followed by a standard phenol-chloroform extraction (Sambrook et al. 2001).
Sequences of the mitochondrial ND4 gene from Massachusetts, Connecticut and Maine populations (Zamudio 2003) were downloaded from the Genbank® database and aligned using ClustalX.
RestrictionMapper (www.restrictionmapper.org) was used to determine potential restriction sites and enzymes.
An Ava II restriction site varied among individuals from the New England populations and was chosen for our analysis (see Figure 1). The presence or absence of the restriction site yields fragments of (510 + 225) or 735 basepairs, respectively.
A 735 basepair fragment of the ND4 gene was amplified using PCR. Primers were obtained from New England Biolabs® Inc. Initial denaturation was performed at 95°C for 5 min. followed by 40 cycles of denaturation at 95°C for 1 min., annealing at 56°C for 1 min. and extension at 72°C for 1.5 min. Final extension occurred at 72°C for 5 min (Zamudio 2003).
The restriction digest was performed using Ava II and agarose gel electrophoresis was used to resolve the RFLPs (see Figure 2).
Tests of population differentiation and analysis of allele frequency data were conducted with StatCrunch (www.statcrunch.com) software.
Figure 1: Aligned ND4 gene fragment sequences (recognition site shown in green)
| CU13014_CT | CTTTATATATATTTCTAATAACCCAACGG | GGTCC | AGTCCCAACCCACTTAAATAAAATAA | |
| CU13226_MA | CTTTATATATATTTCTAATAACCCAACGG | GGTCC | AGTCCCAACCCACTTAAATAAAATAA | |
| CU13225_MA | CTTTATATATATTTCTAATAACCCAACGG | GGTCC | AGTCCCAACCCACTTAAATAAAATAA | |
| JPB9302_ME | CTTTATATATATTTTTAATAACCCAACGG | GGCCC | AGTTCCAACCCACTTAAATAAAATAA | |
| JPB9432_ME | CTTTATATATATTTTTAATAACCCAACGG | GGCCC | AGTTCCAACCCACTTAAATAAAATAA | |
| CU13227_MA | CTTTATATATATTTTTAATAACCCAACGG | GGCCC | AGTTCCAACCCACTTAAATAAAATAA | |
| CU13017_CT | CTTTATATATATTTTTAATAACCCAACGG | GGCCC | AGTTCCAACCCACTTAAATAAAATAA | |
| CU13015_CT | CTTTATATATATTTTTAATAACCCAACGG | GGCCC | AGTTCCAACCCACTTAAATAAAATAA |
Figure 2: Restriction Digest Gel. Cut Allele Can be Seen in Lanes 3. 5. and 8.
Results:
Variation across all populations is not significant
Variation between populations is highly significant (see Table 1)
Regression analysis suggests a significant relationship between the combined independent variables of elevation and mass and the dependent variable, allele frequency (see Figure 3 and Figure 4)
Table 1: Allelle Frequency by Site
| Site | Number of Samples | Frequency of Cut Allele |
Frequency of Uncut Allele |
| Summit | 24 | 5 | 19 |
| Lower Summit | 25 | 1 | 24 |
| Machais | 17 | 1 | 16 |
| Milford | 26 | 7 | 19 |
| Westford | 24 | 20 | 4 |
| Acton | 26 | 22 | 4 |
Figure 3: Map of Sites Showing Allele Frequency, Average Mass and Elevation at Each Site
Figure 4: Multiple Linear Regression Results
Dependent Variable: Allele Frequency
Independent Variable(s): Elevation, Mass
Parameter Estimates:
| Variable | Estimate | Std. Err. | Tstat | P-value |
| Intercept | -81.76205 | 41.277126 | -1.980808 | 0.1419 |
| Altitude | -0.25411254 | 0.04202352 | -6.046912 | 0.0091 |
| Mass | 13.355927 | 3.4873776 | 3.829791 | 0.0314 |
Analysis of variance table for multiple regression model:
| Source | DF | SS | MS | F-stat | P-value |
| Model | 2 | 6396.2466 | 3198.123 | 21.99129 | 0.0161 |
| Error | 3 | 436.28036 | 145.2468 | ||
| Total | 5 | 6832.527 | |||
Root MSE: 12.059303
R-squared: 0.9361
R-squared (adjusted): 0.8936
Discussion:
We examined salamanders inhabiting six pools from four sites, and found a large degree of variation in allele frequency between sites. While ND4 allele frequencies in populations on the summit of Wachusett Mountain are not significantly different from all other sites, strong differences in allele frequencies exist between populations and sites. The two pools on the summit of Wachusett Mountain are separated by a distance of only 350 feet yet a "cut" allele frequency of 20.83% was observed in individuals from the Summit pool while a frequency of only 4.00% was observed in individuals collected from the Lower Summit pool.
Allele frequencies in Acton and Westford are significantly different from those in Machias, Milford and the Summit populations. These findings suggest endemism, which could have been influenced by a barrier to migration and/or fidelity to breeding sites. Such geographical population structuring could facilitate localized adaptation to environmental conditions. Another possibility is a population bottleneck in the recent past of the closely situated Westford and Acton populations. If an event occurred that reduced the population to only a few individuals (specifically females) with the "cut" allele, this otherwise rare allele could drift to high frequency.
Multiple linear regression suggests that two independent variables in combination, elevation and mass, are associated with allele frequency. It should be noted that these two independent variables themselves have a linear relationship; thus, while elevation and mass can together help to predict allele frequency, they should not be considered an explanation for the observed allele frequencies. Nonetheless the observed association between genetic, phenotypic, and environmental differentiation is consistent with local adaptation. One cannot assume however that the ND4 gene, which was used in this study as a marker, is responsible for the observed phenotypic variation. The information gained from this analysis simply confirms genetic variation between populations.
In order to get a better understanding of the correlation between elevation, mass and allele frequency, we intend to expand the study to include other populations (particularly other montaine and low-elevation populations.) Additionally we are extending the genetic analysis to include nuclear microsatellite loci to examine non-maternally inherited genetic differentiation and fine-scale family structure in the salamander populations.
Figure 5: A Nondestructive Method for Extraction of High-Quality DNA
Acknowledgements:
We wish to thank Scott Smyers, Oxbow Associates, Inc. and numerous volunteers.
This work was supported by a grant from The Council on Teaching, Learning, and Research as Scholarship.
Literature Cited:
Fetzner, F. W. J. 1999. Extracting high-quality DNA from shed reptile skins: a simplified method. BioTechniques 26:1052–1054.
Petranka, J. W., Smith, C. K., Scott, A. F., 2004. Identifying the minimal demographic unit for monitoring pond breeding amphibians. Ecological Applications 14:1065–1078.
Sambrook, J. and J. D. Russell, Molecular Cloning, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, ed. 3, 2001).
Zamudio, Kelly R., and Wesley K. Savage. 2003. Historical isolation, range expansion, and secondary contact of two highly divergent mitochondrial lineages in spotted salamanders (Ambystoma maculatum). Evolution 57:1631–1652.